guide rnas grnas Search Results


92
Danaher Inc alt rtm crispr guide rnas
Alt Rtm Crispr Guide Rnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alt rtm crispr guide rnas/product/Danaher Inc
Average 92 stars, based on 1 article reviews
alt rtm crispr guide rnas - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

90
Synthego Inc guide rnas (grna) for crispr knockout
Guide Rnas (Grna) For Crispr Knockout, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rnas (grna) for crispr knockout/product/Synthego Inc
Average 90 stars, based on 1 article reviews
guide rnas (grna) for crispr knockout - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation human ndufv1 guide rnas (grnas)
Papaverine radiosensitizes through complex I inhibition. (A) Western blot of NDI1 expression in mitochondrial fractions of parent A549 and <t>NDUFV1</t> KO cells. (B) Representative trypan blue viability (n = 3) of cells grown in galactose-only media (T = 96 h). Values represent mean viable cells ± SD. (C) Seahorse analysis of the response of parent A549 and NDUFV1 KO ± NDI1 cells to 10 μM papaverine or 1 μM rotenone. Values are mean ± SD. (D) Quantification of pimonidazole staining in NDUFV1 KO NDI1 flank tumors treated with 2 mg/kg PPV or vehicle (n = 3). Value is mean pimonidazole-positive cells from 20 images per tumor ± SEM. P value was calculated with t test. (E) Quantification of tumor growth delay of heterotopic NDUFV1 KO NDI1 flank xenografts receiving either 8 Gy XRT (magenta) or 2 mg/kg PPV 35 min before 8 Gy XRT (blue) (n = 4). Curves represent mean tumor volumes ± SEM. P values were calculated against XRT with t test. n.s., not significant.
Human Ndufv1 Guide Rnas (Grnas), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human ndufv1 guide rnas (grnas)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
human ndufv1 guide rnas (grnas) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation human ikkβ guide rnas (grnas)
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Human Ikkβ Guide Rnas (Grnas), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human ikkβ guide rnas (grnas)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
human ikkβ guide rnas (grnas) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated crispr guide rnas
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Crispr Guide Rnas, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide rnas/product/ToolGen Incorporated
Average 90 stars, based on 1 article reviews
crispr guide rnas - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Broad Institute Inc genes implicated in apoptosis that were upregulated in duodenum of cd44 [geneid=960] knockout mice
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Genes Implicated In Apoptosis That Were Upregulated In Duodenum Of Cd44 [Geneid=960] Knockout Mice, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/genes implicated in apoptosis that were upregulated in duodenum of cd44 [geneid=960] knockout mice/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
genes implicated in apoptosis that were upregulated in duodenum of cd44 [geneid=960] knockout mice - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Benchling Inc crispr guide rnas (grnas) targeting chsting chirf7
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Crispr Guide Rnas (Grnas) Targeting Chsting Chirf7, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide rnas (grnas) targeting chsting chirf7/product/Benchling Inc
Average 90 stars, based on 1 article reviews
crispr guide rnas (grnas) targeting chsting chirf7 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Benchling Inc guide rnas (grnas) flanking rs1191551
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Guide Rnas (Grnas) Flanking Rs1191551, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rnas (grnas) flanking rs1191551/product/Benchling Inc
Average 90 stars, based on 1 article reviews
guide rnas (grnas) flanking rs1191551 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Applied Biological Materials Inc guide rnas (grnas) target 1-42 aaggccgttggacgaagcgg; target 2-47 cgttggacgaagcggtggca; target 3-675 ttaccacccccatgattggc
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Guide Rnas (Grnas) Target 1 42 Aaggccgttggacgaagcgg; Target 2 47 Cgttggacgaagcggtggca; Target 3 675 Ttaccacccccatgattggc, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rnas (grnas) target 1-42 aaggccgttggacgaagcgg; target 2-47 cgttggacgaagcggtggca; target 3-675 ttaccacccccatgattggc/product/Applied Biological Materials Inc
Average 90 stars, based on 1 article reviews
guide rnas (grnas) target 1-42 aaggccgttggacgaagcgg; target 2-47 cgttggacgaagcggtggca; target 3-675 ttaccacccccatgattggc - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Benchling Inc crispr guide rnas (grnas) targeting psting pirf3
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Crispr Guide Rnas (Grnas) Targeting Psting Pirf3, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr guide rnas (grnas) targeting psting pirf3/product/Benchling Inc
Average 90 stars, based on 1 article reviews
crispr guide rnas (grnas) targeting psting pirf3 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation guide rnas (grnas) targeting egfr
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Guide Rnas (Grnas) Targeting Egfr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rnas (grnas) targeting egfr/product/GenScript corporation
Average 90 stars, based on 1 article reviews
guide rnas (grnas) targeting egfr - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Synthego Inc two guide rnas (grnas)
Advanced glycolytic end (AGE) products activates <t>IKKβ</t> signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.
Two Guide Rnas (Grnas), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two guide rnas (grnas)/product/Synthego Inc
Average 90 stars, based on 1 article reviews
two guide rnas (grnas) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Papaverine radiosensitizes through complex I inhibition. (A) Western blot of NDI1 expression in mitochondrial fractions of parent A549 and NDUFV1 KO cells. (B) Representative trypan blue viability (n = 3) of cells grown in galactose-only media (T = 96 h). Values represent mean viable cells ± SD. (C) Seahorse analysis of the response of parent A549 and NDUFV1 KO ± NDI1 cells to 10 μM papaverine or 1 μM rotenone. Values are mean ± SD. (D) Quantification of pimonidazole staining in NDUFV1 KO NDI1 flank tumors treated with 2 mg/kg PPV or vehicle (n = 3). Value is mean pimonidazole-positive cells from 20 images per tumor ± SEM. P value was calculated with t test. (E) Quantification of tumor growth delay of heterotopic NDUFV1 KO NDI1 flank xenografts receiving either 8 Gy XRT (magenta) or 2 mg/kg PPV 35 min before 8 Gy XRT (blue) (n = 4). Curves represent mean tumor volumes ± SEM. P values were calculated against XRT with t test. n.s., not significant.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Papaverine and its derivatives radiosensitize solid tumors by inhibiting mitochondrial metabolism

doi: 10.1073/pnas.1808945115

Figure Lengend Snippet: Papaverine radiosensitizes through complex I inhibition. (A) Western blot of NDI1 expression in mitochondrial fractions of parent A549 and NDUFV1 KO cells. (B) Representative trypan blue viability (n = 3) of cells grown in galactose-only media (T = 96 h). Values represent mean viable cells ± SD. (C) Seahorse analysis of the response of parent A549 and NDUFV1 KO ± NDI1 cells to 10 μM papaverine or 1 μM rotenone. Values are mean ± SD. (D) Quantification of pimonidazole staining in NDUFV1 KO NDI1 flank tumors treated with 2 mg/kg PPV or vehicle (n = 3). Value is mean pimonidazole-positive cells from 20 images per tumor ± SEM. P value was calculated with t test. (E) Quantification of tumor growth delay of heterotopic NDUFV1 KO NDI1 flank xenografts receiving either 8 Gy XRT (magenta) or 2 mg/kg PPV 35 min before 8 Gy XRT (blue) (n = 4). Curves represent mean tumor volumes ± SEM. P values were calculated against XRT with t test. n.s., not significant.

Article Snippet: Three separate human NDUFV1 guide RNAs (gRNAs) were obtained from GenScript (catalog no. SC1678, item no. U5053CH250_1-3).

Techniques: Inhibition, Western Blot, Expressing, Staining

Advanced glycolytic end (AGE) products activates IKKβ signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.

Journal: Cardiovascular Research

Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis

doi: 10.1093/cvr/cvaa118

Figure Lengend Snippet: Advanced glycolytic end (AGE) products activates IKKβ signalling cascade and reduce Mesenchymal stromal cells (MSCs) immunopotency. (A) Western-blot analysis representative of two independent experiments with similar results showing the activation of the IRAK4–TAK1–IKKβ–p65/NF-κB signalling cascade on healthy MSCs that are exposed to 5, 10, and 15 µg/mL AGE products for 24 h. (B–D) AGE induced an increase in the production of IKKβ–NF-κB-regulated pro-inflammatory cytokine IL-6 (***P = 0.0002, n = 8), and chemokines IL-8/CXCL8 (***P = 0.0006, n = 8), MCP-1/CCL2 (***P = 0.0002, n = 8). (E) Reduced immunosuppressive function of MSCs after AGE products (***P = 0.0002, n = 8). Each dot represents different biological replicates (i.e. single healthy control MSCs). Mann–Whitney U test was used to compare two independent groups. Abbreviations: MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; PBMCs, peripheric blood mononuclear cells.

Article Snippet: Six different human IKKβ guide RNAs (gRNAs) (see Supplementary material online , Table S1 ) and non-targeting gRNAs were purchased from GenScript (NJ, USA) and sub-cloned in pLentiCRISPR v2 using BsmBI restriction site (Addgene Plasmid No. 52961).

Techniques: Western Blot, Activation Assay, Control, MANN-WHITNEY

Constitutively activated forms of inflammation-activated protein kinases and increased pro-inflammatory cytokine secretion in atherosclerosis+T2DM MSCs. Augmented active T-loop phosphorylated forms of (A) IRAK 4 (*P = 0.05, atherosclerosis MSCs n = 5, atherosclerosis+T2DM MSCs n = 6), (B) TAK1 (*P = 0.02, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 12) and (C) IKKβ (****P < 0.000, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 11); (D) Increased phosphorylation of p65 NF-κB transcription factor on Ser536 located in its transactivation domain (*P = 0.05, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 12) and (E–G) Increased production of IKKβ–NF-κB-dependent pro-inflammatory cytokine IL-6 (***P = 0.0002, atherosclerosis MSCs n = 12, atherosclerosis+T2DM MSCs n = 11), and chemokines IL-8/CXCL8 (***P = 0.0006, atherosclerosis MSCs n = 11, atherosclerosis+T2DM MSCs n = 10), MCP-1/CCL2 (***P = 0.0002, atherosclerosis MSCs n = 11, atherosclerosis+T2DM MSCs n = 11). Each dot represents different biological samples (i.e. MSC from different donors). Mann–Whitney U test was used to compare two independent groups. Abbreviations: T2DM, type 2 diabetes mellitus; MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1.

Journal: Cardiovascular Research

Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis

doi: 10.1093/cvr/cvaa118

Figure Lengend Snippet: Constitutively activated forms of inflammation-activated protein kinases and increased pro-inflammatory cytokine secretion in atherosclerosis+T2DM MSCs. Augmented active T-loop phosphorylated forms of (A) IRAK 4 (*P = 0.05, atherosclerosis MSCs n = 5, atherosclerosis+T2DM MSCs n = 6), (B) TAK1 (*P = 0.02, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 12) and (C) IKKβ (****P < 0.000, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 11); (D) Increased phosphorylation of p65 NF-κB transcription factor on Ser536 located in its transactivation domain (*P = 0.05, atherosclerosis MSCs n = 10, atherosclerosis+T2DM MSCs n = 12) and (E–G) Increased production of IKKβ–NF-κB-dependent pro-inflammatory cytokine IL-6 (***P = 0.0002, atherosclerosis MSCs n = 12, atherosclerosis+T2DM MSCs n = 11), and chemokines IL-8/CXCL8 (***P = 0.0006, atherosclerosis MSCs n = 11, atherosclerosis+T2DM MSCs n = 10), MCP-1/CCL2 (***P = 0.0002, atherosclerosis MSCs n = 11, atherosclerosis+T2DM MSCs n = 11). Each dot represents different biological samples (i.e. MSC from different donors). Mann–Whitney U test was used to compare two independent groups. Abbreviations: T2DM, type 2 diabetes mellitus; MSCs, mesenchymal stromal cells; TAK-1, transforming growth factor‐β‐activating kinase1; IKKβ, inhibitor of nuclear factor kappa-B kinase subunit beta; p65, nuclear factor kappa-light-chain-enhancer of activated B cells RelA subunit; IRAK4, interleukin-1 receptor-associated kinase 4; IL-6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1.

Article Snippet: Six different human IKKβ guide RNAs (gRNAs) (see Supplementary material online , Table S1 ) and non-targeting gRNAs were purchased from GenScript (NJ, USA) and sub-cloned in pLentiCRISPR v2 using BsmBI restriction site (Addgene Plasmid No. 52961).

Techniques: Phospho-proteomics, MANN-WHITNEY

Pharmacological inhibition of IKKβ reduces pro-inflammatory cytokine and chemokine secretion and rescues in vitro immunopotency of atherosclerosis+T2DM MSCs. (A–C) MLN120B treatment reduces the secretion of IL-6 (***P = 0.001, n = 11), IL-8/CXCL8 (**P = 0.003, n = 9), and MCP-1/CCL2(**P = 0.005, n = 10) in atherosclerosis+T2DM MSCs. (D) Representative example of flow cytometry proliferation. Histograms show CFSE dilution following in vitro proliferation of monocyte-depleted peripheral blood mononuclear cells (PBMCs) in co-culture with atherosclerosis+T2DM MSCs with or without the use of the IKKβ inhibitor MLN120B. (E) MLN120B improved the ability of atherosclerosis+T2DM MSCs to suppress the proliferation of activated T‐cells (***P = 0.0005, n = 12) while not affecting (F) CD4+ T cell viability (n = 12). (G and H) Similar immunopotency and CD4+ T cell viability in both cell–cell contact (n = 4) and trans-well conditions (n = 4) in MLN120B-treated atherosclerosis+T2DM MSCs. Each dot represents different biological samples (i.e. MSC from different donors). Mann–Whitney U test was used to compare two independent groups and Wilcoxon test was used for paired comparisons. Abbreviations: T2DM, type 2 diabetes mellitus; MSCs, mesenchymal stromal cells; IL 6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; FSC‐A, forward scatter area; SSC‐A, side scatter area; SSC‐H, side scatter height; SSC‐W, side scatter width; 7-AAD, 7-aminoactinomycin D; EI, expansion index; CFSE, carboxyfluorescein succinimidyl ester.

Journal: Cardiovascular Research

Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis

doi: 10.1093/cvr/cvaa118

Figure Lengend Snippet: Pharmacological inhibition of IKKβ reduces pro-inflammatory cytokine and chemokine secretion and rescues in vitro immunopotency of atherosclerosis+T2DM MSCs. (A–C) MLN120B treatment reduces the secretion of IL-6 (***P = 0.001, n = 11), IL-8/CXCL8 (**P = 0.003, n = 9), and MCP-1/CCL2(**P = 0.005, n = 10) in atherosclerosis+T2DM MSCs. (D) Representative example of flow cytometry proliferation. Histograms show CFSE dilution following in vitro proliferation of monocyte-depleted peripheral blood mononuclear cells (PBMCs) in co-culture with atherosclerosis+T2DM MSCs with or without the use of the IKKβ inhibitor MLN120B. (E) MLN120B improved the ability of atherosclerosis+T2DM MSCs to suppress the proliferation of activated T‐cells (***P = 0.0005, n = 12) while not affecting (F) CD4+ T cell viability (n = 12). (G and H) Similar immunopotency and CD4+ T cell viability in both cell–cell contact (n = 4) and trans-well conditions (n = 4) in MLN120B-treated atherosclerosis+T2DM MSCs. Each dot represents different biological samples (i.e. MSC from different donors). Mann–Whitney U test was used to compare two independent groups and Wilcoxon test was used for paired comparisons. Abbreviations: T2DM, type 2 diabetes mellitus; MSCs, mesenchymal stromal cells; IL 6, interleukin-6; IL-8, interleukin-8; MCP-1, monocyte chemoattractant protein-1; FSC‐A, forward scatter area; SSC‐A, side scatter area; SSC‐H, side scatter height; SSC‐W, side scatter width; 7-AAD, 7-aminoactinomycin D; EI, expansion index; CFSE, carboxyfluorescein succinimidyl ester.

Article Snippet: Six different human IKKβ guide RNAs (gRNAs) (see Supplementary material online , Table S1 ) and non-targeting gRNAs were purchased from GenScript (NJ, USA) and sub-cloned in pLentiCRISPR v2 using BsmBI restriction site (Addgene Plasmid No. 52961).

Techniques: Inhibition, In Vitro, Flow Cytometry, Co-Culture Assay, MANN-WHITNEY

IKKβ knockdown in atherosclerosis+T2DM-MSCs enhances their immunoprotective effects in the permanent LAD ligation model. (A) Representative western blots showing the efficacy of two different gRNA molecules targeting the IKBKB locus in one control MSCs left either untreated or exposed to 10 ng/mL TNF-α for 10 min. Note that the KD efficiency was evaluated in all the MSCs samples used in vivo (see Supplementary material online, Figure S11). The effect of reducing the expression level of IKKβ in atherosclerosis+T2DM MSCs was evaluated on their (B) immunopotency in vitro (***P = 0.001, n = 11) and (C) ability to attract PBMCs (*P = 0.02, n = 4). (D) Haematoxylin and Eosin (H&E) staining of the injured (i.e. purple: infiltration of leucocytes) and viable myocardium (i.e. pink) (**P = 0.007, n = 8), (E) CD4+ (*P = 0.01, n = 7), (F) Monocyte/macrophage (MOMA-2 staining) (*P = 0.01, n = 7), and (G) FOXP3 (**P = 0.007, n = 8) content in heart sections and (H) IL-6 plasma levels (*P = 0.01, n = 7) were assessed. Each dot represents different animals injected with six different biological samples (i.e. MSC from different donors). Wilcoxon test used for paired groups Abbreviations: T2DM, type 2 diabetes mellitus; PBMCs, peripheric blood mononuclear cells; MOMA, monoclonal anti-macrophage antibody; IL 6, interleukin-6.

Journal: Cardiovascular Research

Article Title: Ex vivo Ikkβ ablation rescues the immunopotency of mesenchymal stromal cells from diabetics with advanced atherosclerosis

doi: 10.1093/cvr/cvaa118

Figure Lengend Snippet: IKKβ knockdown in atherosclerosis+T2DM-MSCs enhances their immunoprotective effects in the permanent LAD ligation model. (A) Representative western blots showing the efficacy of two different gRNA molecules targeting the IKBKB locus in one control MSCs left either untreated or exposed to 10 ng/mL TNF-α for 10 min. Note that the KD efficiency was evaluated in all the MSCs samples used in vivo (see Supplementary material online, Figure S11). The effect of reducing the expression level of IKKβ in atherosclerosis+T2DM MSCs was evaluated on their (B) immunopotency in vitro (***P = 0.001, n = 11) and (C) ability to attract PBMCs (*P = 0.02, n = 4). (D) Haematoxylin and Eosin (H&E) staining of the injured (i.e. purple: infiltration of leucocytes) and viable myocardium (i.e. pink) (**P = 0.007, n = 8), (E) CD4+ (*P = 0.01, n = 7), (F) Monocyte/macrophage (MOMA-2 staining) (*P = 0.01, n = 7), and (G) FOXP3 (**P = 0.007, n = 8) content in heart sections and (H) IL-6 plasma levels (*P = 0.01, n = 7) were assessed. Each dot represents different animals injected with six different biological samples (i.e. MSC from different donors). Wilcoxon test used for paired groups Abbreviations: T2DM, type 2 diabetes mellitus; PBMCs, peripheric blood mononuclear cells; MOMA, monoclonal anti-macrophage antibody; IL 6, interleukin-6.

Article Snippet: Six different human IKKβ guide RNAs (gRNAs) (see Supplementary material online , Table S1 ) and non-targeting gRNAs were purchased from GenScript (NJ, USA) and sub-cloned in pLentiCRISPR v2 using BsmBI restriction site (Addgene Plasmid No. 52961).

Techniques: Knockdown, Ligation, Western Blot, Control, In Vivo, Expressing, In Vitro, Staining, Clinical Proteomics, Injection